C source code for RNA-WL is here. Alternatively, the source code can be downloaded from sourceforge. Python prototype for the Wang-Landau method for the Nussinov energy model of RNA can be found here.


For a small example, consider the bistable switch designed by Flamm, Hofacker and Stadler with sequence CUUAUGAGGGUACUCAUAAGAGUAUCC Depending on parameter settings, RNA-WL can be extremely slow to converge. After running RNA-WL for about 2 minutes, then interrupting the program, the output indicates that the number of Monte-Carlo moves was 10437800, that the minimum sampled free energy is -10.3 kcal/mol, and an initial portion of the output file is:

-10.3		1.043106387e-16		.......((((((((....))))))))
 -9.9		1.043106387e-16		((((((((....)))))))).......
 -7.8		5.695167899e-15		.......(((((((......)))))))
 -7.6		4.20819151e-14		........(((((((....))))))).
 -7.1		8.673729175e-23		.(((((((....)))))))........
 -6.8		7.028395547e-19		(((((((......))))))).......
 -6.3		1.043106387e-16		.......((.(((((....))))).))
See the entire output file here.