Welcome to the RNApathfinder webserver !
Folding pathway between the two meta-stable secondary structures A,B of spliced leader (SL) RNA from Leptomonas collosoma, following LeCuyer and Crothers, who in Proc Natl Acad Sci U S A. 1994 Apr 12;91(8):3373-7 describe stopped-flow rapid-mixing and temperature-jump measurements of the kinetics for this structural transition.
SL RNA sequence:
AACUAAAACAAUUUUUGAAGAACAGUUUCUGUACUUCAUUGGUAUGUAGAGACUUC
Structure A:
..((...((((((..(((((.((((...)))).)))))..))).)))..)).....
Structure B:
.......................((((((((((((.....)))))..)))))))..
Folding pathway determined by TABU-semi-greedy method. Movie produced by RNAmovies.