CLOTE Computational Biology LAB
TEACHING TOOLS: Needleman Wunsch path matrix


Match score       Mismatch score       Linear Gap Penalty
Sequence Input File Input

Enter first sequence

Enter second sequence

OR

Enter first file:

Enter second file:


Example:

  • GCTAGTCAGATCTGACGCTA and GATGGTCACATCTGCCGC

© Boston College